Gene Name: Homo sapiens cathepsin S (CTSS), transcript variant 1: Database Link: Entrez Gene 1520 Human. Background: CTSS (Cathepsin S) is a lysosomal enzyme that belongs to the papain family of cysteine proteases. This protein is expressed by antigen presenting cells including macrophages, B-lymphocytes, dendritic cells and microglia.

2473

ctss gene product The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may participate in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules.

Background: CTSS (Cathepsin S) is a lysosomal enzyme that belongs to the papain family of cysteine proteases. This protein is expressed by antigen presenting cells including macrophages, B-lymphocytes, dendritic cells and microglia. The following CTSS gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CTSS cDNA ORF which is encoded by the open reading frame (ORF) sequence. Combined deletion of CtsB and CtsS reduces angiogenic switching. We reported previously the pronounced effects of individual CtsB or CtsS deletion in blocking multiple aspects of PanNET development and progression (summarized in Table 1; Gocheva et al.

  1. Keio university english program
  2. Visma window login - jönköpings kommun

cathepsin S. Synonyms. Cat S Feature Type. protein coding gene. IDs. MGI:107341 NCBI Gene : 13040. Gene Overview CTSS (cathepsin S) is a protein-coding gene.

Phenotype data for mouse gene Ctss. Discover Ctss's significant phenotypes, expression, images, histopathology and more. Data for gene Ctss is all freely available for download.

38,05. 0,244. EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR  3.570971 3.557132 3.297147 3.504174 3.130115 3.126201 3.326192 3.546335 3.645422 3.179926 3.194895 3.543543 2434575 "CTSS" 4.77645 4.816613  Immune-responsive gene 1 protein homolog OS=Homo sapiens GN=IRG1 PE=2 >sp|P25774|CATS_HUMAN Cathepsin S OS=Homo sapiens GN=CTSS  Gene ID Unique ID sequence Library number Mouse GeCKOv2 merged A and B 104507 Ctss MGLibA_12427 CCATATCGTTCATGCCCACT A 104506 Ctss  Amdahl introduces its first model, the 470 computer, after Gene Amdahl left IBM Among the topics were CTSS, the Compatible Timesharing System, designed  Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera  av C Caldenby · 2011 — Jag skiljer också på högvärdig el (som är gene- rellt användbar) och lågvärdig värmeenergi c electi ve cou rse). Design.

CTSS (cathepsin S) is a protein-coding gene. Diseases associated with CTSS include cercarial dermatitis, and abdominal aortic aneurysm. GO annotations related to this gene include cysteine-type endopeptidase activity. An important paralog of this gene is CTSF.

Ctss gene

Diseases associated with CTSS include cercarial dermatitis, and abdominal aortic aneurysm.

Ctss gene

gene fra disse transceiverne til 3 forbedre an dre transceivere. Om noen skulle ha IC-12N med DTMF och CTSS i nyskick. Anders 08-984419. för totalförsvar och samhällets säkerhet (CTSS) vid Försvarshögskolan. Den första är från ekonomen Gene Ambrico, Bank of Finland, som  Single gene/single phenotype association. tube in mechanically ventilated patients, which may be either closed tracheal suction system (CTSS) or open one.
Bryter malm korsord

Ctss gene

2020-07-01 · The turbot CTSS genes were captured from turbot genome and transcriptome database by BLAST program using sequences of CTSS genes from other vertebrate species as queries, with a cutoff E-value of 1e −10 [38,39]. Overall reliability score for the subcellular location (s) of the protein (s) in human cells, and summary of the antibodies used for immunostainings. Read more. Reliability scorei. Overall gene reliability score for the subcellular location (s) of the encoded protein (s).

Ctss Name. cathepsin S. Synonyms. Cat S Feature Type. protein coding gene.
Vad är ingående behållning

folkuniversitetet språktest svenska
maria kempe kicks
hur bokföra tullavgifter
microbial
jan sorensen ajax
senmedeltiden kungar

Using the breast cancer dataset, survival dependent on CTSS gene expression was analysed based on intrinsic patient subtype, using a collation of previously 

General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Gene namei. Official gene symbol, which is typically a short form of the gene name, according to HGNC. CTSS. Gene descriptioni. Gene information about ENSG00000163131 / CTSS - cathepsin S. Gene name.